Olig1 cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

Olig1 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
783 bp
Description
Full length Clone DNA of Mouse oligodendrocyte transcription factor 1.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Olig1 cDNA ORF Clone, Mouse, untagged: Alternative Names

AI836478 cDNA ORF Clone, Mouse; AW494459 cDNA ORF Clone, Mouse; Bhlhb6 cDNA ORF Clone, Mouse; bHLHe21 cDNA ORF Clone, Mouse; Olg-1 cDNA ORF Clone, Mouse; Oligo1 cDNA ORF Clone, Mouse

Olig1 Background Information

OLIG1 is an oligodendrocyte (OL) transcription factor, which can contribute to the proliferation and differentiation of OLs, and the maturation of myelin.OLIG1 and OLIG2 are basic-helix-loop-helix (bHLH) transcription factors expressed in the pMN domain of the spinal cord, which sequentially generates motoneurons and oligodendrocytes.Multivariate analyses of our data confirmed that OLIG1 protein expression significantly correlates with overall survival in NSCLC patients, with a relative risk of .84 (95% confidence interval .77-.91, p < .1) along with T and N stages, as indicated by a Cox proportional hazard model. So OLIG1 protein expression could be utilized as a novel prognostic factor, which could aid in deciding which NSCLC patients might benefit from more aggressive therapy.
Full Name
oligodendrocyte transcription factor 1
Add to Cart Successfully Add to Cart Failed