Быстрый заказ

Мышь OLFML3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь OLFML3 Информация о продукте «Клон cDNA»
    Размер кДНК:1221bp
    Описание кДНК:Full length Clone DNA of Mus musculus olfactomedin-like 3 with N terminal Myc tag.
    Синоним гена:ONT3, mONT3, AI115209, AW550633, HNOEL-iso, 2810002E22Rik
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    ( We provide with OLFML3 qPCR primers for gene expression analysis, MP201893 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Мышь OLFML3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Мышь OLFML3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52020-ACGRBS15400
    Мышь OLFML3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52020-ACRRBS15400
    Мышь OLFML3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52020-CFRBS13340
    Мышь OLFML3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52020-CHRBS13340
    Мышь OLFML3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52020-CMRBS13340
    Мышь OLFML3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52020-CYRBS13340
    Мышь OLFML3 Джин клон кДНК в вектор клонированияMG52020-GRBS5130
    Мышь OLFML3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52020-NFRBS13340
    Мышь OLFML3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52020-NHRBS13340
    Мышь OLFML3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52020-NMRBS13340
    Мышь OLFML3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52020-NYRBS13340
    Мышь OLFML3 Джин ORF экспрессии кДНК клона плазмидыMG52020-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG52020-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.