After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь OCRL Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse OCRL Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_177215.3
Размер кДНК:2703bp
Описание кДНК:Full length Clone DNA of Mus musculus oculocerebrorenal syndrome of Lowe with C terminal His tag.
Синоним гена:OCRL1, BB143339, 9530014D17Rik, Ocrl
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь OCRL Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь OCRL Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51076-ACGRBS22240
Мышь OCRL Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51076-ACRRBS22240
Мышь OCRL Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51076-ANGRBS22240
Мышь OCRL Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51076-ANRRBS22240
Мышь OCRL Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51076-CFRBS20190
Мышь OCRL Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51076-CHRBS20190
Мышь OCRL Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51076-CMRBS20190
Мышь OCRL Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51076-CYRBS20190
Мышь OCRL Джин клон кДНК в вектор клонированияMG51076-GRBS5130
Мышь OCRL Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51076-NFRBS20190
Мышь OCRL Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51076-NHRBS20190
Мышь OCRL Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51076-NMRBS20190
Мышь OCRL Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51076-NYRBS20190
Мышь OCRL Джин ORF экспрессии кДНК клона плазмидыMG51076-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51076-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».