NUDT10 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52656-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All NUDT10 Reagents

CRO Services

Product recommended


All NUDT10 Reagents

NUDT10 cDNA ORF Clone, Mouse, N-HA tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
495 bp
Description
Full length Clone DNA of Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 10 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NUDT10 cDNA ORF Clone, Mouse, N-HA tag Alternative Names

AI853080 cDNA ORF Clone, Mouse;Dipp3a cDNA ORF Clone, Mouse

NUDT10 Background Information

Full Name
nudix hydrolase 10

NUDT10 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NUDT10 cDNA ORF Clone in Cloning Vector, Mouse MG52656-G
NUDT10 cDNA ORF Clone, Mouse, untagged MG52656-UT
NUDT10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52656-ACGLN
NUDT10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52656-ACG
NUDT10 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52656-ANG
NUDT10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52656-ACR
NUDT10 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52656-ANR
NUDT10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52656-CF
NUDT10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52656-NF
NUDT10 cDNA ORF Clone, Mouse, C-His tag MG52656-CH
NUDT10 cDNA ORF Clone, Mouse, N-His tag MG52656-NH
NUDT10 cDNA ORF Clone, Mouse, C-HA tag MG52656-CY
NUDT10 cDNA ORF Clone, Mouse, C-Myc tag MG52656-CM
NUDT10 cDNA ORF Clone, Mouse, N-Myc tag MG52656-NM
NUDT10 qPCR Primer Pairs, Mouse MP202527

NUDT10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NUDT10 cDNA ORF Clone in Cloning Vector, Human HG15147-G
NUDT10 cDNA ORF Clone, Human, untagged HG15147-UT
NUDT10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15147-ACGLN
NUDT10 cDNA ORF Clone, Human, C-GFPSpark® tag HG15147-ACG
NUDT10 cDNA ORF Clone, Human, N-GFPSpark® tag HG15147-ANG
NUDT10 cDNA ORF Clone, Human, C-OFPSpark® tag HG15147-ACR
NUDT10 cDNA ORF Clone, Human, N-OFPSpark® tag HG15147-ANR
NUDT10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15147-CF
NUDT10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15147-NF
NUDT10 cDNA ORF Clone, Human, C-His tag HG15147-CH
NUDT10 cDNA ORF Clone, Human, N-His tag HG15147-NH
NUDT10 cDNA ORF Clone, Human, C-HA tag HG15147-CY
NUDT10 cDNA ORF Clone, Human, N-HA tag HG15147-NY
NUDT10 cDNA ORF Clone, Human, C-Myc tag HG15147-CM
NUDT10 cDNA ORF Clone, Human, N-Myc tag HG15147-NM
NUDT10 qPCR Primer Pairs, Human HP103774
info info
添加购物车成功! 添加购物车失败!