After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse NUB1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_016736.2
Размер кДНК:1845bp
Описание кДНК:Full length Clone DNA of Mus musculus negative regulator of ubiquitin-like proteins 1.
Синоним гена:BS4, NY-REN-18, 4931404D21Rik, 6330412F12Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51384-ACGRBS16760
Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51384-ACRRBS16760
Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51384-ANGRBS16760
Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51384-ANRRBS16760
Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51384-CFRBS14710
Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51384-CHRBS14710
Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51384-CMRBS14710
Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51384-CYRBS14710
Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51384-NFRBS14710
Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51384-NHRBS14710
Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51384-NMRBS14710
Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51384-NYRBS14710
Мышь NUB1 Джин клон кДНК в вектор клонированияMG51384-URBS5130
Мышь NUB1 Джин ORF экспрессии кДНК клона плазмидыMG51384-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51384-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».