Быстрый заказ

Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь NUB1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_016736.2
    Размер кДНК:1845bp
    Описание кДНК:Full length Clone DNA of Mus musculus negative regulator of ubiquitin-like proteins 1.
    Синоним гена:BS4, NY-REN-18, 4931404D21Rik, 6330412F12Rik
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with NUB1 qPCR primers for gene expression analysis, MP201257 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51384-ACGRBS16760
    Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51384-ACRRBS16760
    Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51384-ANGRBS16760
    Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51384-ANRRBS16760
    Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51384-CFRBS14710
    Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51384-CHRBS14710
    Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51384-CMRBS14710
    Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51384-CYRBS14710
    Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51384-NFRBS14710
    Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51384-NHRBS14710
    Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51384-NMRBS14710
    Мышь NUB1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51384-NYRBS14710
    Мышь NUB1 Джин клон кДНК в вектор клонированияMG51384-URBS5130
    Мышь NUB1 Джин ORF экспрессии кДНК клона плазмидыMG51384-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».