Быстрый заказ

Мышь Neurotrimin Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse NTM Информация о продукте «Клон cDNA»
Размер кДНК:1035bp
Описание кДНК:Full length Clone DNA of Mus musculus neurotrimin with N terminal His tag.
Синоним гена:Hnt, Igdcc2, R75390, 6230410L23Rik, B230210G24Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь Neurotrimin Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь Neurotrimin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51394-ACGRBS15400
Мышь Neurotrimin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51394-ACRRBS15400
Мышь Neurotrimin Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51394-ANGRBS15400
Мышь Neurotrimin Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51394-ANRRBS15400
Мышь Neurotrimin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51394-CFRBS13340
Мышь Neurotrimin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51394-CHRBS13340
Мышь Neurotrimin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51394-CMRBS13340
Мышь Neurotrimin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51394-CYRBS13340
Мышь Neurotrimin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51394-NFRBS13340
Мышь Neurotrimin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51394-NHRBS13340
Мышь Neurotrimin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51394-NMRBS13340
Мышь Neurotrimin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51394-NYRBS13340
Мышь Neurotrimin Джин клон кДНК в вектор клонированияMG51394-URBS5130
Мышь Neurotrimin Джин ORF экспрессии кДНК клона плазмидыMG51394-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51394-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.