Быстрый заказ

Мышь NTF5/Neurotrophin-4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь NTF4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_198190.1
Размер кДНК:630bp
Описание кДНК:Full length Clone DNA of Mus musculus neurotrophin 5 with C terminal His tag.
Синоним гена:NT4, NT-4, Ntf4, NT4/5, Ntf-5, AI462899, 2900040K06Rik
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь NTF5/Neurotrophin-4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь NTF5/Neurotrophin-4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50456-ACGRBS15400
Мышь NTF5/Neurotrophin-4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50456-ACRRBS15400
Мышь NTF5/Neurotrophin-4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50456-CFRBS13340
Мышь NTF5/Neurotrophin-4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50456-CHRBS13340
Мышь NTF5/Neurotrophin-4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50456-CMRBS13340
Мышь NTF5/Neurotrophin-4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50456-CYRBS13340
Мышь NTF5/Neurotrophin-4 Джин клон кДНК в вектор клонированияMG50456-MRBS5130
Мышь NTF5/Neurotrophin-4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50456-NFRBS13340
Мышь NTF5/Neurotrophin-4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50456-NHRBS13340
Мышь NTF5/Neurotrophin-4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50456-NMRBS13340
Мышь NTF5/Neurotrophin-4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50456-NYRBS13340
Мышь NTF5/Neurotrophin-4 Джин ORF экспрессии кДНК клона плазмидыMG50456-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50456-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».