NRGN/Neurogranin cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

NRGN/Neurogranin cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
237 bp
Description
Full length Clone DNA of Mouse neurogranin.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

NRGN/Neurogranin cDNA ORF Clone, Mouse, untagged: Alternative Names

0710001B06Rik cDNA ORF Clone, Mouse; AI838505 cDNA ORF Clone, Mouse; NG cDNA ORF Clone, Mouse; NG/RC3 cDNA ORF Clone, Mouse; Pss1 cDNA ORF Clone, Mouse; R75334 cDNA ORF Clone, Mouse; RC3 cDNA ORF Clone, Mouse

NRGN/Neurogranin Background Information

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait