After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь NRF1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse NRF1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001164227.1
Размер кДНК:1605bp
Описание кДНК:Full length Clone DNA of Mus musculus nuclear respiratory factor 1 with N terminal Myc tag.
Синоним гена:C87038, D6Ertd415e
Виды:Mouse
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь NRF1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь NRF1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52011-ACGRBS16760
Мышь NRF1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52011-ACRRBS16760
Мышь NRF1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52011-ANGRBS16760
Мышь NRF1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52011-ANRRBS16760
Мышь NRF1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52011-CFRBS14710
Мышь NRF1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52011-CHRBS14710
Мышь NRF1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52011-CMRBS14710
Мышь NRF1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52011-CYRBS14710
Мышь NRF1 Джин клон кДНК в вектор клонированияMG52011-GRBS5130
Мышь NRF1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52011-NFRBS14710
Мышь NRF1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52011-NHRBS14710
Мышь NRF1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52011-NMRBS14710
Мышь NRF1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52011-NYRBS14710
Мышь NRF1 Джин ORF экспрессии кДНК клона плазмидыMG52011-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».