Neuropeptide Y cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

1/1
Price:
Size:
Number:

Neuropeptide Y cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
333 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse canopy 4 homolog (zebrafish) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + XbaI(6kb+1.84kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Neuropeptide Y cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Neuropeptide Y cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: Validated Images

Neuropeptide Y cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: Alternative Names

0710005A05Rik cDNA ORF Clone, Mouse

Neuropeptide Y Background Information

Neuropeptide Y (NPY) is a neuromodulator that is widely expressed throughout the central nervous system (CNS) and which is cosecreted with classic neurotransmitters including GABA and glutamate. Neuropeptide Y (NPY)/Agouti-related protein (AgRP) neurons in the arcuate nucleus of the hypothalamus are part of a neuroendocrine feedback loop that regulates feeding behavior and glucose homeostasis. NPY/AgRP neurons sense peripheral signals (including the hormones leptin, insulin, and ghrelin) and integrate those signals with inputs from other brain regions.Neuropeptide Y (NPY) plays different roles in mammals such as: regulate food intake, memory retention, cardiovascular functions, and anxiety.
Full Name
neuropeptide Y
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait