Быстрый заказ

Мышь NPY ORF mammalian expression plasmid, C-Flag Метка

  • Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5619
ПаспортОбзорыСвязанные продуктыПротоколы
Мышь NPY Информация о продукте «Клон cDNA»
Размер кДНК:333 bp
Описание кДНК:Full length Clone DNA of Mus musculus canopy 4 homolog (zebrafish) with C terminal Flag tag.
Синоним гена:0710005A05Rik
Участок рестрикции:HindIII + XbaI(6kb+1.84kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
( We provide with NPY qPCR primers for gene expression analysis, MP200973 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь NPY ORF mammalian expression plasmid, C-Flag Метка on other vectors
Мышь NPY/Pro-neuropeptide Y Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51013-ACGRBS15400
Мышь NPY/Pro-neuropeptide Y Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51013-ACRRBS15400
Мышь NPY ORF mammalian expression plasmid, C-Flag МеткаMG51013-CFRBS13340
Мышь NPY/Pro-neuropeptide Y Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51013-CHRBS13340
Мышь NPY/Pro-neuropeptide Y Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51013-CMRBS13340
Мышь NPY/Pro-neuropeptide Y Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51013-CYRBS13340
Мышь NPY/Pro-neuropeptide Y Джин клон кДНК в вектор клонированияMG51013-GRBS5130
Мышь NPY/Pro-neuropeptide Y Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51013-NFRBS13340
Мышь NPY/Pro-neuropeptide Y Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51013-NHRBS13340
Мышь NPY/Pro-neuropeptide Y Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51013-NMRBS13340
Мышь NPY/Pro-neuropeptide Y Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51013-NYRBS13340
Мышь NPY/Pro-neuropeptide Y Джин ORF экспрессии кДНК клона плазмидыMG51013-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51013-CF
Цена по прейскуранту: 
Цена:      (You Save: )

Datasheet & Documentation

Contact Us
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.