Быстрый заказ

Text Size:AAA

Мышь NPNT/Nephronectin Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse NPNT Информация о продукте «Клон cDNA»
Размер кДНК:1686bp
Описание кДНК:Full length Clone DNA of Mus musculus nephronectin with N terminal Myc tag.
Синоним гена:Nctn, POEM, AA682063, AI314031, 1110009H02Rik, Npnt
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь NPNT/Nephronectin Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь NPNT/Nephronectin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50210-ACGRBS16760
Мышь NPNT/Nephronectin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50210-ACRRBS16760
Мышь NPNT/Nephronectin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50210-CFRBS14710
Мышь NPNT/Nephronectin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50210-CHRBS14710
Мышь NPNT/Nephronectin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50210-CMRBS14710
Мышь NPNT/Nephronectin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50210-CYRBS14710
Мышь NPNT/Nephronectin Джин клон кДНК в вектор клонированияMG50210-MRBS5130
Мышь NPNT/Nephronectin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50210-NFRBS14710
Мышь NPNT/Nephronectin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50210-NHRBS14710
Мышь NPNT/Nephronectin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50210-NMRBS14710
Мышь NPNT/Nephronectin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50210-NYRBS14710
Мышь NPNT/Nephronectin Джин ORF экспрессии кДНК клона плазмидыMG50210-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50210-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.