After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь CCN3 / NOV (IGFBP9) Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse NOV Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_010930.4
Размер кДНК:1065bp
Описание кДНК:Full length Clone DNA of Mus musculus nephroblastoma overexpressed gene with C terminal His tag.
Синоним гена:CCN3, C130088N23Rik
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь CCN3 / NOV (IGFBP9) Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь CCN3 / NOV (IGFBP9) Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50455-ACGRBS15400
Мышь CCN3 / NOV (IGFBP9) Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50455-ACRRBS15400
Мышь CCN3 / NOV (IGFBP9) Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50455-CFRBS13340
Мышь CCN3 / NOV (IGFBP9) Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50455-CHRBS13340
Мышь CCN3 / NOV (IGFBP9) Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50455-CMRBS13340
Мышь CCN3 / NOV (IGFBP9) Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50455-CYRBS13340
Мышь CCN3 / NOV (IGFBP9) Джин клон кДНК в вектор клонированияMG50455-MRBS5130
Мышь CCN3 / NOV (IGFBP9) Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50455-NFRBS13340
Мышь CCN3 / NOV (IGFBP9) Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50455-NHRBS13340
Мышь CCN3 / NOV (IGFBP9) Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50455-NMRBS13340
Мышь CCN3 / NOV (IGFBP9) Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50455-NYRBS13340
Мышь CCN3 / NOV (IGFBP9) Джин ORF экспрессии кДНК клона плазмидыMG50455-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Protein NOV homolog, also known as Nephroblastoma-overexpressed gene protein homolog, NOV, and CCN3, is a putative ligand for integrin receptors, is tightly associated with the extracellular matrix and mediates diverse cellular functions, including cell adhesion and proliferation. CCN3 has been shown to negatively regulate growth although it promotes migration in a cell type-specific manner. This secreted protein belongs to the CCN family, and its expression was observed in a broad variety of tissues from the early stage of development , and altered expression of CCN3 has been observed in a variety of tumors, including hepatocellular carcinomas, Wilm's tumors, Ewing's sarcomas, gliomas, rhabdomyosarcomas, and adrenocortical carcinomas. Mature CCN3 protein has five distinct modules and truncated protein variants with altered function are found in many cancers. CCN3 acts through the core stem cell signalling pathways including Notch and Bone Morphogenic Protein, connecting CCN3 with the modulation of self-renewal and maturation of a number of cell lineages including hematopoietic, osteogenic and chondrogenic. CCN3 may affect the extracellular environment of the niche for hematopoietic stem cells. CCN3 has emerged as a key player in stem cell regulation, hematopoiesis and a crucial component within the bone marrow microenvironment.

Ссылки
  • Manara MC, et al. (2002) The expression of ccn3(nov) gene in musculoskeletal tumors. Am J Pathol. 160(3): 849-59.
  • Lin CG, et al. (2003) CCN3 (NOV) is a novel angiogenic regulator of the CCN protein family. J Biol Chem. 278(26): 24200-8.
  • Vallacchi V, et al. (2009) CCN3/nephroblastoma overexpressed matricellular protein regulates integrin expression, adhesion, and dissemination in melanoma. Cancer Res. 68(3): 715-23.
  • Sin WC, et al. (2009) Matricellular protein CCN3 (NOV) regulates actin cytoskeleton reorganization. J Biol Chem. 284(43): 29935-44.
  • McCallum L, et al. (2009) CCN3--a key regulator of the hematopoietic compartment. Blood Rev. 23(2): 79-85.
  • Size / Price
    Каталог: MG50455-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».