Neuroligin 1 cDNA ORF Clone, Mouse, N-His tag

Price:
Size:
Number:

Neuroligin 1 cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2532 bp
Description
Full length Clone DNA of Mouse neuroligin 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Neuroligin 1 cDNA ORF Clone, Mouse, N-His tag: Alternative Names

6330415N05Rik cDNA ORF Clone, Mouse; BB179718 cDNA ORF Clone, Mouse; mKIAA1070 cDNA ORF Clone, Mouse; NL1 cDNA ORF Clone, Mouse; Nlg1 cDNA ORF Clone, Mouse

Neuroligin 1 Background Information

Neuroligin 1 (NLGN1) belongs to the type-B carboxylesterase/lipase family, is a synaptic cell-adhesion molecule that is enriched in postsynaptic densities where it may recruit receptors, channels, and signal-transduction molecules to synaptic sites of cell adhesion. Neuroligins consist of five members (NLGN1, NLGN2, NLGN3, NLGN4 and NLGN4Y), which interact with beta-neurexins and this interaction is involved in the formation of functional synapses. The extracellular domain of functional Neuroligin 1 associates as a dimer when analyzed by sedimentation equilibrium. Neuroligin 1 has a unique N-linked glycosylation pattern in the neuroligin family, and glycosylation and its processing modify neuroligin activity. Neuroligin 1 is a potent trigger for the de novo formation of synaptic connections, and it has recently been suggested that it is required for the maturation of functionally competent excitatory synapses. The persistent expression of Neuroligin 1 is required for the maintenance of NMDAR-mediated synaptic transmission, which enables normal development of synaptic plasticity and long-term memory in the amygdala of adult animals.
Full Name
neuroligin 1
References
  • Song JY, et al. (1999) Neuroligin 1 is a postsynaptic cell-adhesion molecule of excitatory synapses. Proc Natl Acad Sci U S A. 96(3): 1100-5.
  • Comoletti D, et al. (2003) Characterization of the interaction of a recombinant soluble neuroligin-1 with neurexin-1beta. J Biol Chem. 278(50): 50497-505.
  • Ylisaukko-oja T, et al. (2005) Analysis of four neuroligin genes as candidates for autism. Eur J Hum Genet. 13(12): 1285-92.
  • Kim J, et al. (2008) Neuroligin-1 is required for normal expression of LTP and associative fear memory in the amygdala of adult animals. Proc Natl Acad Sci U S A. 105(26): 9087-92.
  • Schapitz IU, et al. (2010) Neuroligin 1 is dynamically exchanged at postsynaptic sites. J Neurosci. 30(38): 12733-44.

Neuroligin 1 cDNA ORF Clone, Cynomolgus, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait