Быстрый заказ

Мышь Neuroligin 1/NLGN1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse NLGN1 Информация о продукте «Клон cDNA»
Размер кДНК:2532bp
Описание кДНК:Full length Clone DNA of Mus musculus neuroligin 1 with N terminal His tag.
Синоним гена:BB179718, MGC107366, mKIAA1070, 6330415N05Rik, Nlgn1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь Neuroligin 1/NLGN1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь Neuroligin 1/NLGN1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50725-ACGRBS22238
Мышь Neuroligin 1/NLGN1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50725-ACRRBS22238
Мышь Neuroligin 1/NLGN1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50725-CFRBS20185
Мышь Neuroligin 1/NLGN1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50725-CHRBS20185
Мышь Neuroligin 1/NLGN1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50725-CMRBS20185
Мышь Neuroligin 1/NLGN1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50725-CYRBS20185
Мышь Neuroligin 1/NLGN1 Джин клон кДНК в вектор клонированияMG50725-MRBS5132
Мышь Neuroligin 1/NLGN1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50725-NFRBS20185
Мышь Neuroligin 1/NLGN1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50725-NHRBS20185
Мышь Neuroligin 1/NLGN1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50725-NMRBS20185
Мышь Neuroligin 1/NLGN1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50725-NYRBS20185
Мышь Neuroligin 1/NLGN1 Джин ORF экспрессии кДНК клона плазмидыMG50725-UTRBS20185
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Neuroligin 1 (NLGN1) belongs to the type-B carboxylesterase/lipase family, is a synaptic cell-adhesion molecule that is enriched in postsynaptic densities where it may recruit receptors, channels, and signal-transduction molecules to synaptic sites of cell adhesion. Neuroligins consist of five members (NLGN1, NLGN2, NLGN3, NLGN4 and NLGN4Y), which interact with beta-neurexins and this interaction is involved in the formation of functional synapses. The extracellular domain of functional Neuroligin 1 associates as a dimer when analyzed by sedimentation equilibrium. Neuroligin 1 has a unique N-linked glycosylation pattern in the neuroligin family, and glycosylation and its processing modify neuroligin activity. Neuroligin 1 is a potent trigger for the de novo formation of synaptic connections, and it has recently been suggested that it is required for the maturation of functionally competent excitatory synapses. The persistent expression of Neuroligin 1 is required for the maintenance of NMDAR-mediated synaptic transmission, which enables normal development of synaptic plasticity and long-term memory in the amygdala of adult animals.

  • Song JY, et al. (1999) Neuroligin 1 is a postsynaptic cell-adhesion molecule of excitatory synapses. Proc Natl Acad Sci U S A. 96(3): 1100-5.
  • Comoletti D, et al. (2003) Characterization of the interaction of a recombinant soluble neuroligin-1 with neurexin-1beta. J Biol Chem. 278(50): 50497-505.
  • Ylisaukko-oja T, et al. (2005) Analysis of four neuroligin genes as candidates for autism. Eur J Hum Genet. 13(12): 1285-92.
  • Kim J, et al. (2008) Neuroligin-1 is required for normal expression of LTP and associative fear memory in the amygdala of adult animals. Proc Natl Acad Sci U S A. 105(26): 9087-92.
  • Schapitz IU, et al. (2010) Neuroligin 1 is dynamically exchanged at postsynaptic sites. J Neurosci. 30(38): 12733-44.
  • Size / Price
    Каталог: MG50725-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.