After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь NGF/NGFB/beta-NGF transcript variant B Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse NGF Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001112698.1
Размер кДНК:726bp
Описание кДНК:Full length Clone DNA of Mus musculus nerve growth factor, transcript variant B with C terminal Myc tag.
Синоним гена:Ngfb, Ngf
Виды:Mouse
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь NGF/NGFB/beta-NGF transcript variant B Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь NGF/NGFB/beta-NGF transcript variant B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50385-ACGRBS15400
Мышь NGF/NGFB/beta-NGF transcript variant B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50385-ACRRBS15400
Мышь NGF/NGFB/beta-NGF transcript variant B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50385-CFRBS13340
Мышь NGF/NGFB/beta-NGF transcript variant B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50385-CHRBS13340
Мышь NGF/NGFB/beta-NGF transcript variant B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50385-CMRBS13340
Мышь NGF/NGFB/beta-NGF transcript variant B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50385-CYRBS13340
Мышь NGF/NGFB/beta-NGF transcript variant B Джин клон кДНК в вектор клонированияMG50385-MRBS5130
Мышь NGF/NGFB/beta-NGF transcript variant B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50385-NFRBS13340
Мышь NGF/NGFB/beta-NGF transcript variant B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50385-NHRBS13340
Мышь NGF/NGFB/beta-NGF transcript variant B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50385-NMRBS13340
Мышь NGF/NGFB/beta-NGF transcript variant B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50385-NYRBS13340
Мышь NGF/NGFB/beta-NGF transcript variant B Джин ORF экспрессии кДНК клона плазмидыMG50385-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Nerve growth factor (NGF) is important for the development and maintenance of the sympathetic and sensory nervous systems. NGF protein was identified as a large complex consisting of three non-covalently linked subunits, α, β, and γ, among which, the β subunit, called β-NGF (beta-NGF), was demonstrated to exhibits the growth stimulating activity of NGF protein. NGFB/beta-NGF gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. NGF protein acts via at least two receptors on the surface of cells (TrkA and p75 receptors) to regulate neuronal survival, promote neurite outgrowth, and up-regulate certain neuronal functions such as mediation of pain and inflammation. In addition, previous studies indicated that NGF may also have an important role in the regulation of the immune system.

Ссылки
  • Castellanos MR, et al. (2003) Evaluation of the neurorestorative effects of the murine beta-nerve growth factor infusions in old rat with cognitive deficit. Biochem Biophys Res Commun. 312(4): 867-72.
  • Wang TH, et al. (2008) Effects of pcDNA3-beta-NGF gene-modified BMSC on the rat model of Parkinson's disease. J Mol Neurosci. 35(2): 161-9.
  • Perrard MH, et al. (2009) Redundancy of the effect of TGFbeta1 and beta-NGF on the second meiotic division of rat spermatocytes. Microsc Res Tech. 72(8): 596-602.
  • Size / Price
    Каталог: MG50385-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».