After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь NELFA/WHSC2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse NELFA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_011914.2
Размер кДНК:1593bp
Описание кДНК:Full length Clone DNA of Mus musculus negative elongation factor complex member A, Whsc2.
Синоним гена:Whsc2, Whsc2h
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь NELFA/WHSC2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь NELFA/WHSC2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51363-ACGRBS16760
Мышь NELFA/WHSC2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51363-ACRRBS16760
Мышь NELFA/WHSC2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51363-ANGRBS16760
Мышь NELFA/WHSC2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51363-ANRRBS16760
Мышь NELFA/WHSC2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51363-CFRBS14710
Мышь NELFA/WHSC2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51363-CHRBS14710
Мышь NELFA/WHSC2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51363-CMRBS14710
Мышь NELFA/WHSC2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51363-CYRBS14710
Мышь NELFA/WHSC2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51363-NFRBS14710
Мышь NELFA/WHSC2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51363-NHRBS14710
Мышь NELFA/WHSC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51363-NMRBS14710
Мышь NELFA/WHSC2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51363-NYRBS14710
Мышь NELFA/WHSC2 Джин клон кДНК в вектор клонированияMG51363-URBS5130
Мышь NELFA/WHSC2 Джин ORF экспрессии кДНК клона плазмидыMG51363-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51363-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».