NDUFS8 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52404-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All NDUFS8 Reagents

CRO Services

Product recommended


All NDUFS8 Reagents

NDUFS8 cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
639 bp
Description
Full length Clone DNA of Mouse NADH dehydrogenase (ubiquinone) Fe-S protein 8 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NDUFS8 cDNA ORF Clone, Mouse, N-His tag Alternative Names

BC021616 cDNA ORF Clone, Mouse;CI-23kD cDNA ORF Clone, Mouse;TYKY cDNA ORF Clone, Mouse

NDUFS8 Background Information

Full Name
NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)

NDUFS8 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NDUFS8 cDNA ORF Clone in Cloning Vector, Rat RG80824-U
NDUFS8 cDNA ORF Clone, Rat, untagged RG80824-UT
NDUFS8 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80824-ACG
NDUFS8 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80824-ACGLN
NDUFS8 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80824-ANG
NDUFS8 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80824-ACR
NDUFS8 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80824-ANR
NDUFS8 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80824-CF
NDUFS8 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80824-NF
NDUFS8 cDNA ORF Clone, Rat, C-His tag RG80824-CH
NDUFS8 cDNA ORF Clone, Rat, N-His tag RG80824-NH
NDUFS8 cDNA ORF Clone, Rat, C-HA tag RG80824-CY
NDUFS8 cDNA ORF Clone, Rat, N-HA tag RG80824-NY
NDUFS8 cDNA ORF Clone, Rat, C-Myc tag RG80824-CM
NDUFS8 cDNA ORF Clone, Rat, N-Myc tag RG80824-NM
NDUFS8 qPCR Primer Pairs, Rat RP300788

NDUFS8 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NDUFS8 cDNA ORF Clone in Cloning Vector, Mouse MG52404-U
NDUFS8 cDNA ORF Clone, Mouse, untagged MG52404-UT
NDUFS8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52404-ACG
NDUFS8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52404-ACGLN
NDUFS8 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52404-ANG
NDUFS8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52404-ACR
NDUFS8 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52404-ANR
NDUFS8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52404-CF
NDUFS8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52404-NF
NDUFS8 cDNA ORF Clone, Mouse, C-His tag MG52404-CH
NDUFS8 cDNA ORF Clone, Mouse, C-HA tag MG52404-CY
NDUFS8 cDNA ORF Clone, Mouse, N-HA tag MG52404-NY
NDUFS8 cDNA ORF Clone, Mouse, C-Myc tag MG52404-CM
NDUFS8 cDNA ORF Clone, Mouse, N-Myc tag MG52404-NM
NDUFS8 qPCR Primer Pairs, Mouse MP202277

NDUFS8 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NDUFS8 cDNA ORF Clone in Cloning Vector, Human HG16338-G
NDUFS8 cDNA ORF Clone, Human, untagged HG16338-UT
NDUFS8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16338-ACGLN
NDUFS8 cDNA ORF Clone, Human, C-GFPSpark® tag HG16338-ACG
NDUFS8 cDNA ORF Clone, Human, N-GFPSpark® tag HG16338-ANG
NDUFS8 cDNA ORF Clone, Human, C-OFPSpark® tag HG16338-ACR
NDUFS8 cDNA ORF Clone, Human, N-OFPSpark® tag HG16338-ANR
NDUFS8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16338-CF
NDUFS8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16338-NF
NDUFS8 cDNA ORF Clone, Human, C-His tag HG16338-CH
NDUFS8 cDNA ORF Clone, Human, N-His tag HG16338-NH
NDUFS8 cDNA ORF Clone, Human, C-HA tag HG16338-CY
NDUFS8 cDNA ORF Clone, Human, N-HA tag HG16338-NY
NDUFS8 cDNA ORF Clone, Human, C-Myc tag HG16338-CM
NDUFS8 cDNA ORF Clone, Human, N-Myc tag HG16338-NM
NDUFS8 qPCR Primer Pairs, Human HP105091
info info
添加购物车成功! 添加购物车失败!