NDUFS3 cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

NDUFS3 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
792 bp
Description
Full length Clone DNA of Mouse NADH dehydrogenase (ubiquinone) Fe-S protein 3.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

NDUFS3 cDNA ORF Clone, Mouse, untagged: Alternative Names

0610010M09Rik cDNA ORF Clone, Mouse; CI-30kD cDNA ORF Clone, Mouse

NDUFS3 Background Information

NDUFS3 is an integral subunit of the Q module of the mitochondrial respiratory Complex-I. Expression of the mitochondrial protein, nicotinamide adenine dinucleotide dehydrogenase (ubiquinone) Fe-S protein 3 (NDUFS3), down-regulates in some cancers including breast and kidney. NDUFS3 expression is down-regulated in serous ovarian adenocarcinoma, suggesting that NDUFS3 may contribute to the development of serous ovarian cancer.Besides being a robust indicator of breast cancer aggressiveness, NDUFS3 also shows clear signatures of a hypoxia/necrosis marker in invasive ductal carcinoma specimens.
Full Name
NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait