After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь NDUFS3 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse NDUFS3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_026688.2
Размер кДНК:792bp
Описание кДНК:Full length Clone DNA of Mus musculus NADH dehydrogenase (ubiquinone) Fe-S protein 3.
Синоним гена:CI-30kD; 0610010M09Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь NDUFS3 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь NDUFS3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51333-ACGRBS15400
Мышь NDUFS3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51333-ACRRBS15400
Мышь NDUFS3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51333-ANGRBS15400
Мышь NDUFS3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51333-ANRRBS15400
Мышь NDUFS3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51333-CFRBS13340
Мышь NDUFS3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51333-CHRBS13340
Мышь NDUFS3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51333-CMRBS13340
Мышь NDUFS3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51333-CYRBS13340
Мышь NDUFS3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51333-NFRBS13340
Мышь NDUFS3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51333-NHRBS13340
Мышь NDUFS3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51333-NMRBS13340
Мышь NDUFS3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51333-NYRBS13340
Мышь NDUFS3 Джин клон кДНК в вектор клонированияMG51333-URBS5130
Мышь NDUFS3 Джин ORF экспрессии кДНК клона плазмидыMG51333-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51333-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».