After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь NDNL2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse NDNL2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_023239.4
Размер кДНК:840bp
Описание кДНК:Full length Clone DNA of Mus musculus necdin-like 2 with N terminal His tag.
Синоним гена:HCA4; Mageg1; mage-g1; AI642138; BB044375; 5730494G16Rik
Виды:Mouse
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь NDNL2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь NDNL2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51970-ACGRBS15400
Мышь NDNL2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51970-ACRRBS15400
Мышь NDNL2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51970-ANGRBS15400
Мышь NDNL2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51970-ANRRBS15400
Мышь NDNL2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51970-CFRBS13340
Мышь NDNL2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51970-CHRBS13340
Мышь NDNL2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51970-CMRBS13340
Мышь NDNL2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51970-CYRBS13340
Мышь NDNL2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51970-NFRBS13340
Мышь NDNL2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51970-NHRBS13340
Мышь NDNL2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51970-NMRBS13340
Мышь NDNL2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51970-NYRBS13340
Мышь NDNL2 Джин клон кДНК в вектор клонированияMG51970-URBS5130
Мышь NDNL2 Джин ORF экспрессии кДНК клона плазмидыMG51970-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51970-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».