Быстрый заказ

Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь NCF2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_010877.4
    Размер кДНК:1578bp
    Описание кДНК:Full length Clone DNA of Mus musculus neutrophil cytosolic factor 2.
    Синоним гена:NOXA2, Ncf-2, p67phox
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with NCF2 qPCR primers for gene expression analysis, MP202322 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52449-ACGRBS16760
    Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52449-ACRRBS16760
    Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52449-ANGRBS16760
    Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52449-ANRRBS16760
    Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52449-CFRBS14710
    Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52449-CHRBS14710
    Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52449-CMRBS14710
    Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52449-CYRBS14710
    Мышь NCF2 / NCF-2 / P67phox Джин клон кДНК в вектор клонированияMG52449-GRBS5130
    Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52449-NFRBS14710
    Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52449-NHRBS14710
    Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52449-NMRBS14710
    Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52449-NYRBS14710
    Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмидыMG52449-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    NCF2, also known as NCF-2 and p67phox, is a subunit of the multi-protein NADPH oxidase complex. NCF2, NCF1, and a membrane bound cytochrome b558 are required for activation of the latent NADPH oxidase. This oxidase produces a burst of superoxide which is delivered to the lumen of the neutrophil phagosome. Mutations in NCF2 gene, as well as in other NADPH oxidase subunits, can result in chronic granulomatous disease, a disease that causes recurrent infections by catalase-positive organisms.

    Ссылки
  • Wientjes FB. et al., 1996, Semin Cell Biol. 6 (6): 357-65.
  • DeLeo FR. et al., 1997, J Leukoc Biol. 60 (6): 677-91.
  • Dorseuil O. et al., 1997, C R Seances Soc Biol Fil. 191 (2): 237-46.
  • Size / Price
    Каталог: MG52449-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».