After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse NCF2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_010877.4
Размер кДНК:1578bp
Описание кДНК:Full length Clone DNA of Mus musculus neutrophil cytosolic factor 2.
Синоним гена:NOXA2, Ncf-2, p67phox
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52449-ACGRBS16760
Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52449-ACRRBS16760
Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52449-ANGRBS16760
Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52449-ANRRBS16760
Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52449-CFRBS14710
Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52449-CHRBS14710
Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52449-CMRBS14710
Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52449-CYRBS14710
Мышь NCF2 / NCF-2 / P67phox Джин клон кДНК в вектор клонированияMG52449-GRBS5130
Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52449-NFRBS14710
Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52449-NHRBS14710
Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52449-NMRBS14710
Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52449-NYRBS14710
Мышь NCF2 / NCF-2 / P67phox Джин ORF экспрессии кДНК клона плазмидыMG52449-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

NCF2, also known as NCF-2 and p67phox, is a subunit of the multi-protein NADPH oxidase complex. NCF2, NCF1, and a membrane bound cytochrome b558 are required for activation of the latent NADPH oxidase. This oxidase produces a burst of superoxide which is delivered to the lumen of the neutrophil phagosome. Mutations in NCF2 gene, as well as in other NADPH oxidase subunits, can result in chronic granulomatous disease, a disease that causes recurrent infections by catalase-positive organisms.

Ссылки
  • Wientjes FB. et al., 1996, Semin Cell Biol. 6 (6): 357-65.
  • DeLeo FR. et al., 1997, J Leukoc Biol. 60 (6): 677-91.
  • Dorseuil O. et al., 1997, C R Seances Soc Biol Fil. 191 (2): 237-46.
  • Size / Price
    Каталог: MG52449-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».