After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь NCALD Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse NCALD Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001170868.1
Размер кДНК:582bp
Описание кДНК:Full length Clone DNA of Mus musculus neurocalcin delta.
Синоним гена:AI848120, D15Ertd412e, D030020D09Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь NCALD Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь NCALD Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51340-ACGRBS15396
Мышь NCALD Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51340-ACRRBS15396
Мышь NCALD Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51340-ANGRBS15396
Мышь NCALD Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51340-ANRRBS15396
Мышь NCALD Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51340-CFRBS13343
Мышь NCALD Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51340-CHRBS13343
Мышь NCALD Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51340-CMRBS13343
Мышь NCALD Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51340-CYRBS13343
Мышь NCALD Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51340-NFRBS13343
Мышь NCALD Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51340-NHRBS13343
Мышь NCALD Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51340-NMRBS13343
Мышь NCALD Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51340-NYRBS13343
Мышь NCALD Джин клон кДНК в вектор клонированияMG51340-URBS5132
Мышь NCALD Джин ORF экспрессии кДНК клона плазмидыMG51340-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51340-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».