MYZAP/GCOM1 cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

MYZAP/GCOM1 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1401 bp
Description
Full length Clone DNA of Mouse myocardial zonula adherens protein.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MYZAP/GCOM1 cDNA ORF Clone, Mouse, untagged: Alternative Names

AA407270 cDNA ORF Clone, Mouse; AV006038 cDNA ORF Clone, Mouse; Gcom1 cDNA ORF Clone, Mouse; Gm640 cDNA ORF Clone, Mouse; Grinl1a7 cDNA ORF Clone, Mouse; Myozap cDNA ORF Clone, Mouse

MYZAP/GCOM1 Background Information

Full Name
myocardial zonula adherens protein
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait