Быстрый заказ

Мышь MYZAP/GCOM1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MYZAP Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC139078.1
Размер кДНК:1401bp
Описание кДНК:Full length Clone DNA of Mus musculus myocardial zonula adherens protein.
Синоним гена:Gcom1, Gm640, Myozap, AA407270, AV006038, Grinl1a7
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь MYZAP/GCOM1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь MYZAP/GCOM1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51343-ACGRBS15400
Мышь MYZAP/GCOM1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51343-ACRRBS15400
Мышь MYZAP/GCOM1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51343-CFRBS13340
Мышь MYZAP/GCOM1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51343-CHRBS13340
Мышь MYZAP/GCOM1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51343-CMRBS13340
Мышь MYZAP/GCOM1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51343-CYRBS13340
Мышь MYZAP/GCOM1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51343-NFRBS13340
Мышь MYZAP/GCOM1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51343-NHRBS13340
Мышь MYZAP/GCOM1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51343-NMRBS13340
Мышь MYZAP/GCOM1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51343-NYRBS13340
Мышь MYZAP/GCOM1 Джин клон кДНК в вектор клонированияMG51343-URBS5130
Мышь MYZAP/GCOM1 Джин ORF экспрессии кДНК клона плазмидыMG51343-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51343-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».