Быстрый заказ

Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь MYL12B Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_023402.2
    Размер кДНК:519bp
    Описание кДНК:Full length Clone DNA of Mus musculus myosin, light chain 12B, regulatory with N terminal His tag.
    Синоним гена:RLC-B, C77744, Mylc2b, 1500001M02Rik
    Виды:Mouse
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MYL12B qPCR primers for gene expression analysis, MP200704 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50729-ACGRBS15400
    Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50729-ACRRBS15400
    Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50729-ANGRBS15400
    Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50729-ANRRBS15400
    Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50729-CFRBS13340
    Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50729-CHRBS13340
    Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50729-CMRBS13340
    Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50729-CYRBS13340
    Мышь MYL12B Джин клон кДНК в вектор клонированияMG50729-GRBS5130
    Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50729-NFRBS13340
    Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50729-NHRBS13340
    Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50729-NMRBS13340
    Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50729-NYRBS13340
    Мышь MYL12B Джин ORF экспрессии кДНК клона плазмидыMG50729-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG50729-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».