Быстрый заказ

Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MYL12B Информация о продукте «Клон cDNA»
Размер кДНК:519bp
Описание кДНК:Full length Clone DNA of Mus musculus myosin, light chain 12B, regulatory with N terminal His tag.
Синоним гена:RLC-B, C77744, Mylc2b, 1500001M02Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50729-ACGRBS15396
Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50729-ACRRBS15396
Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50729-ANGRBS15396
Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50729-ANRRBS15396
Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50729-CFRBS13343
Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50729-CHRBS13343
Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50729-CMRBS13343
Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50729-CYRBS13343
Мышь MYL12B Джин клон кДНК в вектор клонированияMG50729-GRBS5132
Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50729-NFRBS13343
Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50729-NHRBS13343
Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50729-NMRBS13343
Мышь MYL12B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50729-NYRBS13343
Мышь MYL12B Джин ORF экспрессии кДНК клона плазмидыMG50729-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50729-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.