After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь MTMR7 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MTMR7 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001040699.1
Размер кДНК:1983bp
Описание кДНК:Full length Clone DNA of Mus musculus myotubularin related protein 7.
Синоним гена:Mtmr7
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь MTMR7 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь MTMR7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52468-ACGRBS16764
Мышь MTMR7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52468-ACRRBS16764
Мышь MTMR7 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52468-ANGRBS16764
Мышь MTMR7 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52468-ANRRBS16764
Мышь MTMR7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52468-CFRBS14711
Мышь MTMR7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52468-CHRBS14711
Мышь MTMR7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52468-CMRBS14711
Мышь MTMR7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52468-CYRBS14711
Мышь MTMR7 Джин клон кДНК в вектор клонированияMG52468-GRBS5132
Мышь MTMR7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52468-NFRBS14711
Мышь MTMR7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52468-NHRBS14711
Мышь MTMR7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52468-NMRBS14711
Мышь MTMR7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52468-NYRBS14711
Мышь MTMR7 Джин ORF экспрессии кДНК клона плазмидыMG52468-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52468-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».