After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь MTHFD2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MTHFD2 Информация о продукте «Клон cDNA»
Размер кДНК:1053bp
Описание кДНК:Full length Clone DNA of Mus musculus methylenetetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase with N terminal His tag.
Синоним гена:NMDMC, AW558851
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь MTHFD2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь MTHFD2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52822-ACGRBS15400
Мышь MTHFD2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52822-ACRRBS15400
Мышь MTHFD2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52822-ANGRBS15400
Мышь MTHFD2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52822-ANRRBS15400
Мышь MTHFD2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52822-CFRBS13340
Мышь MTHFD2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52822-CHRBS13340
Мышь MTHFD2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52822-CMRBS13340
Мышь MTHFD2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52822-CYRBS13340
Мышь MTHFD2 Джин клон кДНК в вектор клонированияMG52822-GRBS5130
Мышь MTHFD2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52822-NFRBS13340
Мышь MTHFD2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52822-NHRBS13340
Мышь MTHFD2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52822-NMRBS13340
Мышь MTHFD2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52822-NYRBS13340
Мышь MTHFD2 Джин ORF экспрессии кДНК клона плазмидыMG52822-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52822-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.