Быстрый заказ

Мышь GDF-8/Myostatin/MSTN Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MSTN Информация о продукте «Клон cDNA»
Размер кДНК:1131bp
Описание кДНК:Full length Clone DNA of Mus musculus myostatin with N terminal Flag tag.
Синоним гена:Cmpt, Gdf8, MGC124261, MGC124262, MGC124263, Mstn
Участок рестрикции:KpnI + XbaI (6kb + 1.18kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse MSTN Gene Plasmid Map
Mouse MSTN natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь GDF-8/Myostatin/MSTN Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь GDF-8/Myostatin/MSTN Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50441-ACGRBS15400
Мышь GDF-8/Myostatin/MSTN Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50441-ACRRBS15400
Мышь GDF-8/Myostatin/MSTN Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50441-CFRBS13340
Мышь GDF-8/Myostatin/MSTN Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50441-CHRBS13340
Мышь GDF-8/Myostatin/MSTN Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50441-CMRBS13340
Мышь GDF-8/Myostatin/MSTN Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50441-CYRBS13340
Мышь GDF-8/Myostatin/MSTN Джин клон кДНК в вектор клонированияMG50441-GRBS5130
Мышь GDF-8/Myostatin/MSTN Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50441-NFRBS13340
Мышь GDF-8/Myostatin/MSTN Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50441-NHRBS13340
Мышь GDF-8/Myostatin/MSTN Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50441-NMRBS13340
Мышь GDF-8/Myostatin/MSTN Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50441-NYRBS13340
Мышь GDF-8/Myostatin/MSTN Джин ORF экспрессии кДНК клона плазмидыMG50441-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

GDF-8 / Myostatin / MSTN is a member of the bone morphogenetic protein (BMP) family and the TGF-beta superfamily. This group of proteins is characterized by a polybasic proteolytic processing site which is cleaved to produce a mature protein containing seven conserved cysteine residues. The members of this family are regulators of cell growth and differentiation in both embryonic and adult tissues. GDF-8 / Myostatin / MSTN is highly expressed in skeletal muscle, and myostatin loss-of-function leads to doubling of skeletal muscle mass. Experiments in mice have improved that GDF-8 / Myostatin / MSTN is a key regulator of mesenchymal stem cell proliferation and differentiation, and mice lacking Myostatin encoding gene show decreased body fat and a generalized increase in bone density and strength. The increase in bone density is observed in most anatomical regions, including the limbs, spine, and jaw, and myostatin inhibitors have been observed to significantly increase bone formation. GDF-8 / Myostatin / MSTN is also expressed in the early phases of fracture healing, and GDF-8 / Myostatin / MSTN deficiency leads to increased fracture callus size and strength. Together, these data suggest that GDF-8 / Myostatin / MSTN has direct effects on the proliferation and differentiation of osteoprogenitor cells, and that GDF-8/Myostatin/MSTN antagonists and inhibitors are likely to enhance both muscle mass and bone strength.

  • Elkasrawy MN, et al. (2010) Myostatin (GDF-8) as a key factor linking muscle mass and bone structure. J Musculoskelet Neuronal Interact. 10(1): 56-63.
  • Kambadur R, et al. (1997) Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle. Genome Res. 7 (9): 910-6.
  • McPherron AC, et al. (1997) Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature. 387 (6628): 83-90.
  • Size / Price
    Каталог: MG50441-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Mouse MSTN natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.