Быстрый заказ

Text Size:AAA

Мышь MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MST4 Информация о продукте «Клон cDNA»
Размер кДНК:1020bp
Описание кДНК:Full length Clone DNA of Mus musculus RIKEN cDNA 2610018G03 gene with C terminal His tag.
Синоним гена:Mst4, RP23-245F8.1, 2610018G03Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51088-ACGRBS15400
Мышь MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51088-ACRRBS15400
Мышь MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51088-ANGRBS15400
Мышь MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51088-ANRRBS15400
Мышь MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51088-CFRBS13340
Мышь MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51088-CHRBS13340
Мышь MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51088-CMRBS13340
Мышь MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51088-CYRBS13340
Мышь MST4/MST-4 Джин клон кДНК в вектор клонированияMG51088-GRBS5130
Мышь MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51088-NFRBS13340
Мышь MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51088-NHRBS13340
Мышь MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51088-NMRBS13340
Мышь MST4/MST-4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51088-NYRBS13340
Мышь MST4/MST-4 Джин ORF экспрессии кДНК клона плазмидыMG51088-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

MST4, also known as mammalian STE20-like protein kinase 4, is a novel member of the germinal center kinase subfamily of human Ste20-like kinases and is closely related to MST3. The 416 amino acid full-length MST4 contains a C-terminal regulatory domain and an N-terminal kinase domain, both of which are required for full activation of the kinase. MST4 is highly expressed in placenta, thymus, and peripheral blood leukocytes. MST4 specifically activates ERK but not JNK or p38 MAPK in transient transfected cells or in stable cell lines, and thus is biologically active in the activation of MEK/ERK pathway mediating cell growth and transformation. Further, MST4 kinase activity is stimulated significantly by epidermal growth factor receptor (EGFR) ligands, which are known to promote growth of certain cancer cells. Accordingly, MST4 have a potential role in signal transduction pathways involved in cancer progression. Three alternatively spliced isoform of MST4 have been isolated, and isoform 3 lacks an exon encoding kinase domain and may function as a dominant-negative regulator of the MST4 kinase.


1. Qian, Z. et al., 2001, J Biol Chem. 276 :22439-45.

2. Lin, JL. et al., 2001, Oncogene. 20: 6559-6569.

3. Sung V, et al., 2003, Cancer research. 63: 3356-63.

4. Ma, X. et al., 2007, Molecular biology of the cell. 18:1965-78.

5. ten Klooster JP, et al., 2009, Developmental cell. 16:551-62.

Size / Price
Каталог: MG51088-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.