Быстрый заказ

Мышь CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MS4A1 Информация о продукте «Клон cDNA»
Размер кДНК:876bp
Описание кДНК:Full length Clone DNA of Mus musculus membrane-spanning 4-domains, subfamily A, member 1 with C terminal Flag tag.
Синоним гена:Cd20, Ly-44, Ms4a2, AA960661, Ms4a1
Участок рестрикции:KpnI (two restriction sites) + XbaI (6kb + 0.24kb + 0.68kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse MS4A1 Gene Plasmid Map
Mouse MS4A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
Mouse MS4A1 Gene Expression validated Image
Mouse MS4A1 natural ORF mammalian expression plasmid, C-Flag tag
[Щелкните, чтобы увеличить изображение]
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Мышь CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50399-ACGRBS15400
Мышь CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50399-ACRRBS15400
Мышь CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50399-CFRBS13340
Мышь CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50399-CHRBS13340
Мышь CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50399-CMRBS13340
Мышь CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50399-CYRBS13340
Мышь CD20/MS4A1 Джин клон кДНК в вектор клонированияMG50399-GRBS5130
Мышь CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмидыMG50399-G-NRBS13340
Мышь CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50399-NFRBS13340
Мышь CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50399-NHRBS13340
Мышь CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50399-NMRBS13340
Мышь CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50399-NYRBS13340
Мышь CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмидыMG50399-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CD20 (membrane-spanning 4-domains, subfamily A, member 1), also known as MS4A1, is a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. CD20 / MS4A1 is expressed on all stages of B cell development except the first and last. CD20 / MS4A1 is present from pre-pre B cells through memory cells, but not on either pro-B cells or plasma cells. It is a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. CD20 / MS4A1may be involved in the regulation of B-cell activation and proliferation. Defects in CD20 / MS4A1 are the cause of immunodeficiency common variable type 5(CVID5). CVID5 is a primary immunodeficiency characterized by antibody deficiency, hypogammaglobulinemia, recurrent bacterial infections and an inability to mount an antibody response to antigen. The defect results from a failure of B-cell differentiation and impaired secretion of immunoglobulins; the numbers of circulating B-cells is usually in the normal range, but can be low.

  • Tedder TF, et al. (1988) Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes. Proc Natl Acad Sci. 85(1): 208-12.
  • Cragg MS, et al. (2005) The biology of CD20 and its potential as a target for mAb therapy. Curr Dir Autoimmun. 8: 140-74..
  • Polyak MJ, et al. (2003) A cholesterol-dependent CD20 epitope detected by the FMC7 antibody. Leukemia. 17(7): 1384-9.
  • Size / Price
    Каталог: MG50399-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Mouse MS4A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
    • Mouse MS4A1 natural ORF mammalian expression plasmid, C-Flag tag
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.