Быстрый заказ

Мышь MRPS34 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MRPS34 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_023260.1
Размер кДНК:657bp
Описание кДНК:Full length Clone DNA of Mus musculus mitochondrial ribosomal protein S34 with N terminal His tag.
Синоним гена:Tce2; AV001970; 0610007F04Rik; 5330430D13Rik
Виды:Mouse
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь MRPS34 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь MRPS34 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51983-ACGRBS15396
Мышь MRPS34 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51983-ACRRBS15396
Мышь MRPS34 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51983-ANGRBS15396
Мышь MRPS34 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51983-ANRRBS15396
Мышь MRPS34 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51983-CFRBS13343
Мышь MRPS34 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51983-CHRBS13343
Мышь MRPS34 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51983-CMRBS13343
Мышь MRPS34 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51983-CYRBS13343
Мышь MRPS34 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51983-NFRBS13343
Мышь MRPS34 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51983-NHRBS13343
Мышь MRPS34 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51983-NMRBS13343
Мышь MRPS34 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51983-NYRBS13343
Мышь MRPS34 Джин клон кДНК в вектор клонированияMG51983-URBS5132
Мышь MRPS34 Джин ORF экспрессии кДНК клона плазмидыMG51983-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51983-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».