After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MRPL12 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_027204.2
Размер кДНК:606bp
Описание кДНК:Full length Clone DNA of Mus musculus mitochondrial ribosomal protein L12.
Синоним гена:Rpml12, MRP-L12, 0610034O11Rik, 1500031N16Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51350-ACGRBS15396
Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51350-ACRRBS15396
Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51350-ANGRBS15396
Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51350-ANRRBS15396
Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51350-CFRBS13343
Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51350-CHRBS13343
Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51350-CMRBS13343
Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51350-CYRBS13343
Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51350-NFRBS13343
Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51350-NHRBS13343
Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51350-NMRBS13343
Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51350-NYRBS13343
Мышь MRPL12 Джин клон кДНК в вектор клонированияMG51350-URBS5132
Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмидыMG51350-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51350-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».