Быстрый заказ

Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь MRPL12 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_027204.2
    Размер кДНК:606bp
    Описание кДНК:Full length Clone DNA of Mus musculus mitochondrial ribosomal protein L12.
    Синоним гена:Rpml12, MRP-L12, 0610034O11Rik, 1500031N16Rik
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MRPL12 qPCR primers for gene expression analysis, MP201227 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51350-ACGRBS15400
    Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51350-ACRRBS15400
    Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51350-ANGRBS15400
    Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51350-ANRRBS15400
    Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51350-CFRBS13340
    Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51350-CHRBS13340
    Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51350-CMRBS13340
    Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51350-CYRBS13340
    Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51350-NFRBS13340
    Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51350-NHRBS13340
    Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51350-NMRBS13340
    Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51350-NYRBS13340
    Мышь MRPL12 Джин клон кДНК в вектор клонированияMG51350-URBS5130
    Мышь MRPL12 Джин ORF экспрессии кДНК клона плазмидыMG51350-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51350-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».