Быстрый заказ

Мышь MPI/Mannose Phosphate Isomerase Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MPI Информация о продукте «Клон cDNA»
Размер кДНК:1272bp
Описание кДНК:Full length Clone DNA of Mus musculus mannose phosphate isomerase with N terminal His tag.
Синоним гена:Mpi1, Mpi-1, AI315153, 1110002E17Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь MPI/Mannose Phosphate Isomerase Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь MPI/Mannose Phosphate Isomerase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52533-ACGRBS15396
Мышь MPI/Mannose Phosphate Isomerase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52533-ACRRBS15396
Мышь MPI/Mannose Phosphate Isomerase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52533-ANGRBS15396
Мышь MPI/Mannose Phosphate Isomerase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52533-ANRRBS15396
Мышь MPI/Mannose Phosphate Isomerase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52533-CFRBS13343
Мышь MPI/Mannose Phosphate Isomerase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52533-CHRBS13343
Мышь MPI/Mannose Phosphate Isomerase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52533-CMRBS13343
Мышь MPI/Mannose Phosphate Isomerase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52533-CYRBS13343
Мышь MPI/Mannose Phosphate Isomerase Джин клон кДНК в вектор клонированияMG52533-GRBS5132
Мышь MPI/Mannose Phosphate Isomerase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52533-NFRBS13343
Мышь MPI/Mannose Phosphate Isomerase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52533-NHRBS13343
Мышь MPI/Mannose Phosphate Isomerase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52533-NMRBS13343
Мышь MPI/Mannose Phosphate Isomerase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52533-NYRBS13343
Мышь MPI/Mannose Phosphate Isomerase Джин ORF экспрессии кДНК клона плазмидыMG52533-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52533-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.