Быстрый заказ

Text Size:AAA

Мышь MPHOSPH6 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MPHOSPH6 Информация о продукте «Клон cDNA»
Размер кДНК:486bp
Описание кДНК:Full length Clone DNA of Mus musculus M phase phosphoprotein 6 with N terminal HA tag.
Синоним гена:C86426, AA536809, 1110001M01Rik
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь MPHOSPH6 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь MPHOSPH6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52816-ACGRBS15396
Мышь MPHOSPH6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52816-ACRRBS15396
Мышь MPHOSPH6 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52816-ANGRBS15400
Мышь MPHOSPH6 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52816-ANRRBS15396
Мышь MPHOSPH6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52816-CFRBS13343
Мышь MPHOSPH6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52816-CHRBS13343
Мышь MPHOSPH6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52816-CMRBS13343
Мышь MPHOSPH6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52816-CYRBS13343
Мышь MPHOSPH6 Джин клон кДНК в вектор клонированияMG52816-GRBS5130
Мышь MPHOSPH6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52816-NFRBS13343
Мышь MPHOSPH6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52816-NHRBS13340
Мышь MPHOSPH6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52816-NMRBS13343
Мышь MPHOSPH6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52816-NYRBS13340
Мышь MPHOSPH6 Джин ORF экспрессии кДНК клона плазмидыMG52816-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52816-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.