Быстрый заказ

Text Size:AAA

Мышь MMP9/MMP-9/CLG4B Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MMP9 Информация о продукте «Клон cDNA»
Размер кДНК:2193bp
Описание кДНК:Full length Clone DNA of Mus musculus matrix metallopeptidase 9 with N terminal HA tag.
Синоним гена:Clg4b, MMP-9, B/MMP9, AW743869, pro-MMP-9, Mmp9
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь MMP9/MMP-9/CLG4B Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь MMP9/MMP-9/CLG4B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50560-ACGRBS16760
Мышь MMP9/MMP-9/CLG4B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50560-ACRRBS16760
Мышь MMP9/MMP-9/CLG4B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50560-CFRBS14710
Мышь MMP9/MMP-9/CLG4B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50560-CHRBS14710
Мышь MMP9/MMP-9/CLG4B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50560-CMRBS14710
Мышь MMP9/MMP-9/CLG4B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50560-CYRBS14710
Мышь MMP9/MMP-9/CLG4B Джин клон кДНК в вектор клонированияMG50560-MRBS5130
Мышь MMP9/MMP-9/CLG4B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50560-M-HRBS14710
Мышь MMP9/MMP-9/CLG4B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50560-NFRBS14710
Мышь MMP9/MMP-9/CLG4B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50560-NHRBS14710
Мышь MMP9/MMP-9/CLG4B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50560-NMRBS14710
Мышь MMP9/MMP-9/CLG4B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50560-NYRBS14710
Мышь MMP9/MMP-9/CLG4B Джин ORF экспрессии кДНК клона плазмидыMG50560-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Matrix metalloproteinases (MMPs) are neutral proteinases that are involved in the breakdown and remodeling of the extracellular matrix (ECM) under a variety of physiological and pathological conditions, such as morphogenesis, differentiation, angiogenesis and tissue remodeling, as well as pathological processes including inflammation, arthritis, cardiovascular diseases, pulmonary diseases and tumor invasion. MMP9, also known as 92-kDa gelatinase B/type IV collagenase, is secreted from neutrophils, macrophages, and a number of transformed cells, and is the most complex family member in terms of domain structure and regulation of its activity. It plays an important role in tissue remodelling in normal and pathological inflammatory processes. MMP-9 is a major secretion product of macrophages and a component of cytoplasmic granules of neutrophils, and is particularly important in the pathogenesis of inflammatory, infectious, and neoplastic diseases in many organs including the lung. This enzyme is also secreted by lymphocytes and stromal cells upon stimulation by inflammatory cytokines, or upon delivery of bi-directional activation signals following integrin-mediated cell-cell or cell-extracellular matrix (ECM) contacts. Since the integrity of the tissue architecture is closely dependent of the delicate balance between MMPs and their inhibitors, excessive production of MMP-9 is linked to tissue damage and degenerative inflammatory disorders. As a consequence, regulation of gene transcription and tissue-specific expression of MMP-9 in normal and diseased states are being actively investigated to pave the way for new therapeutic targets. In addition, the dramatic overexpression of MMP-9 in cancer and various inflammatory conditions clearly points to the molecular mechanisms controlling its expression as a potential target for eventual rational therapeutic intervention.

  • St-Pierre Y, et al. (2003) Emerging features in the regulation of MMP-9 gene expression for the development of novel molecular targets and therapeutic strategies. Curr Drug Targets Inflamm Allergy. 2(3): 206-15.
  • St-Pierre Y, et al. (2004) Regulation of MMP-9 gene expression for the development of novel molecular targets against cancer and inflammatory diseases. Expert Opin Ther Targets. 8(5): 473-89.
  • Chakrabarti S, et al. (2005) Matrix metalloproteinase-2 (MMP-2) and MMP-9 in pulmonary pathology. Exp Lung Res. 31(6): 599-621.
  • Size / Price
    Каталог: MG50560-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.