MMP-8 cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

MMP-8 cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1398 bp
Description
Full length Clone DNA of Mouse matrix metallopeptidase 8 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MMP-8 cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

BB138268 cDNA ORF Clone, Mouse

MMP-8 Background Information

Matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that degrade components of the extracellular matrix (ECM) and play essential roles in various physiological processes such as morphogenesis, differentiation, angiogenesis and tissue remodeling, as well as pathological processes including inflammation, arthritis, cardiovascular diseases, pulmonary diseases and tumor invasion. Neutrophil collagenase, also known as Matrix metalloproteinase-8, MMP-8, and CLG1, is a member of the peptidase M1A family. MMP-8 may affect the metastatic behaviour of breast cancer cells through protection against lymph node metastasis, underlining the importance of anti-target identification in drug development. MMP-8 in the tumour may have a protective effect against lymph node metastasis. MMP-8 may affect the metastatic behaviour of breast cancer cells through protection against lymph node metastasis, underlining the importance of anti-target identification in drug development. MMP-8 participates in wound repair by contributing to the resolution of inflammation and open the possibility to develop new strategies for treating wound healing defects.
Full Name
matrix metallopeptidase 8
References
  • Hasty K.A., et al.,(1990), Human neutrophil collagenase. A distinct gene product with homology to other matrix metalloproteinases. J. Biol. Chem. 265:11421-11424.
  • Blaeser J., et al., (1991), Mercurial activation of human polymorphonuclear leucocyte procollagenase.Eur. J. Biochem. 202:1223-1230.
  • Blaeser J., et al.,(1991), Mercurial activation of human polymorphonuclear leucocyte procollagenase. Eur. J. Biochem. 202:1223-1230.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait