Быстрый заказ

Text Size:AAA

Мышь MMP-8 / MMP8 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MMP8 Информация о продукте «Клон cDNA»
Размер кДНК:1398bp
Описание кДНК:Full length Clone DNA of Mus musculus matrix metallopeptidase 8 with C terminal HA tag.
Синоним гена:BB138268, Mmp8
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь MMP-8 / MMP8 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь MMP-8 / MMP8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50493-ACGRBS15400
Мышь MMP-8 / MMP8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50493-ACRRBS15400
Мышь MMP-8 / MMP8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50493-CFRBS13340
Мышь MMP-8 / MMP8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50493-CHRBS13340
Мышь MMP-8 / MMP8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50493-CMRBS13340
Мышь MMP-8 / MMP8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50493-CYRBS13340
Мышь MMP-8 / MMP8 Джин клон кДНК в вектор клонированияMG50493-MRBS5130
Мышь MMP-8 / MMP8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50493-NFRBS13340
Мышь MMP-8 / MMP8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50493-NHRBS13340
Мышь MMP-8 / MMP8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50493-NMRBS13340
Мышь MMP-8 / MMP8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50493-NYRBS13340
Мышь MMP-8 / MMP8 Джин ORF экспрессии кДНК клона плазмидыMG50493-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that degrade components of the extracellular matrix (ECM) and play essential roles in various physiological processes such as morphogenesis, differentiation, angiogenesis and tissue remodeling, as well as pathological processes including inflammation, arthritis, cardiovascular diseases, pulmonary diseases and tumor invasion. Neutrophil collagenase, also known as Matrix metalloproteinase-8, MMP-8, and CLG1, is a member of the peptidase M10A family. MMP-8 may affect the metastatic behaviour of breast cancer cells through protection against lymph node metastasis, underlining the importance of anti-target identification in drug development. MMP-8 in the tumour may have a protective effect against lymph node metastasis. MMP-8 may affect the metastatic behaviour of breast cancer cells through protection against lymph node metastasis, underlining the importance of anti-target identification in drug development. MMP-8 participates in wound repair by contributing to the resolution of inflammation and open the possibility to develop new strategies for treating wound healing defects.

Size / Price
Каталог: MG50493-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.