After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь MMP-7/MMP7 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MMP7 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_010810.4
Размер кДНК:804bp
Описание кДНК:Full length Clone DNA of Mus musculus matrix metallopeptidase 7 with C terminal HA tag.
Синоним гена:MAT, Mmp7
Виды:Mouse
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь MMP-7/MMP7 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь MMP-7/MMP7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50492-ACGRBS15400
Мышь MMP-7/MMP7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50492-ACRRBS15400
Мышь MMP-7/MMP7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50492-CFRBS13340
Мышь MMP-7/MMP7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50492-CHRBS13340
Мышь MMP-7/MMP7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50492-CMRBS13340
Мышь MMP-7/MMP7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50492-CYRBS13340
Мышь MMP-7/MMP7 Джин клон кДНК в вектор клонированияMG50492-MRBS5130
Мышь MMP-7/MMP7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50492-NFRBS13340
Мышь MMP-7/MMP7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50492-NHRBS13340
Мышь MMP-7/MMP7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50492-NMRBS13340
Мышь MMP-7/MMP7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50492-NYRBS13340
Мышь MMP-7/MMP7 Джин ORF экспрессии кДНК клона плазмидыMG50492-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that degrade components of the extracellular matrix (ECM) and play essential roles in various physiological and pathological processes such as morphogenesis, differentiation, angiogenesis, tissue remodeling, and tumor invasion. MMPs are synthesized as pro-enzymes and converted to active form by extracellular proteinases. MMP7, also referred to as matrilysin, is the smallest member of the MMP family and differs from other MMP members in that it lacks the C-terminal hemopexin-like domain. MMP7 is produced primarily by mucosal epithelia, and is capable of degrading various ECM proteins including proteoglycans, fibronectin, elastin and casein. This enzyme serves essential functions in both innate defense and wound healing, and appears to be one of the most important MMPs in human colon cancers. It has been reported that MMP7 contributes to tumor malignancy probably by cleaving cell surface proteins such as Fas ligand, degradation of IgG or inducing E-cadherin-mediated cell aggregation. In addition, matrilysin is also identified as a mediator of pulmonary fibrosis and a potential therapeutic target.

Size / Price
Каталог: MG50492-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».