Быстрый заказ

Мышь MMD2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь MMD2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_175217.6
    Размер кДНК:744bp
    Описание кДНК:Full length Clone DNA of Mus musculus monocyte to macrophage differentiation-associated 2 with N terminal HA tag.
    Синоним гена:C88001; 4930518M15Rik
    Виды:Mouse
    переносчик:pCMV3-N-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MMD2 qPCR primers for gene expression analysis, MP201917 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Мышь MMD2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Мышь MMD2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52044-ACGRBS15400
    Мышь MMD2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52044-ACRRBS15400
    Мышь MMD2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52044-ANGRBS15400
    Мышь MMD2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52044-ANRRBS15400
    Мышь MMD2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52044-CFRBS13340
    Мышь MMD2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52044-CHRBS13340
    Мышь MMD2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52044-CMRBS13340
    Мышь MMD2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52044-CYRBS13340
    Mouse MMD2 Gene cDNA clone plasmidMG52044-GRBS5130
    Мышь MMD2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52044-NFRBS13340
    Мышь MMD2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52044-NHRBS13340
    Мышь MMD2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52044-NMRBS13340
    Мышь MMD2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52044-NYRBS13340
    Мышь MMD2 Джин клон кДНК в вектор клонированияMG52044-URBS5130
    Мышь MMD2 Джин ORF экспрессии кДНК клона плазмидыMG52044-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG52044-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».