After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь MIF4GD Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MIF4GD Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_027162.4
Размер кДНК:669bp
Описание кДНК:Full length Clone DNA of Mus musculus MIF4G domain containing with N terminal Myc tag.
Синоним гена:1110014L05Rik, 2310075G12Rik
Виды:Mouse
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь MIF4GD Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь MIF4GD Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52027-ACGRBS15400
Мышь MIF4GD Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52027-ACRRBS15400
Мышь MIF4GD Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52027-ANGRBS15400
Мышь MIF4GD Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52027-ANRRBS15400
Мышь MIF4GD Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52027-CFRBS13340
Мышь MIF4GD Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52027-CHRBS13340
Мышь MIF4GD Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52027-CMRBS13340
Мышь MIF4GD Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52027-CYRBS13340
Мышь MIF4GD Джин клон кДНК в вектор клонированияMG52027-GRBS5130
Мышь MIF4GD Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52027-NFRBS13340
Мышь MIF4GD Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52027-NHRBS13340
Мышь MIF4GD Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52027-NMRBS13340
Мышь MIF4GD Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52027-NYRBS13340
Мышь MIF4GD Джин ORF экспрессии кДНК клона плазмидыMG52027-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52027-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».