MGAT3 cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

MGAT3 cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1617 bp
Description
Full length Clone DNA of Mouse mannoside acetylglucosaminyltransferase 3 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MGAT3 cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

1110038J12Rik cDNA ORF Clone, Mouse; AI848272 cDNA ORF Clone, Mouse; GnT-III cDNA ORF Clone, Mouse

MGAT3 Background Information

Full Name
mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase

MGAT3 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait