Быстрый заказ

Мышь MESDC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MESDC2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_023403.2
Размер кДНК:674bp
Описание кДНК:Full length Clone DNA of Mus musculus mesoderm development candidate 2 with N terminal Myc tag.
Синоним гена:AW537813, MGC25959, mKIAA0081, 2210015O11Rik, Mesdc2
Виды:Mouse
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь MESDC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь MESDC2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50200-ACGRBS15400
Мышь MESDC2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50200-ACRRBS15400
Мышь MESDC2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50200-CFRBS13340
Мышь MESDC2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50200-CHRBS13340
Мышь MESDC2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50200-CMRBS13340
Мышь MESDC2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50200-CYRBS13340
Мышь MESDC2 Джин клон кДНК в вектор клонированияMG50200-MRBS5130
Мышь MESDC2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50200-NFRBS13340
Мышь MESDC2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50200-NHRBS13340
Мышь MESDC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50200-NMRBS13340
Мышь MESDC2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50200-NYRBS13340
Мышь MESDC2 Джин ORF экспрессии кДНК клона плазмидыMG50200-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

LDLR chaperone MESD, also known as Mesoderm development protein, Mesoderm development candidate 2, Renal carcinoma antigen NY-REN-61 and MESDC2, is a member of the MESD family. MESDC2 is a chaperone specifically assisting the folding of beta-propeller/EGF modules within the family of low-density lipoprotein receptors (LDLRs). The LDLR maturation activity resides in the N- and C-terminal unstructured regions. MESDC2 acts as a modulator of the Wnt pathway, since some LDLRs are coreceptors for the canonical Wnt pathway. MESDC2 is essential for specification of embryonic polarity and mesoderm induction.

Ссылки
  • Scanlan M.J. et al., 1999, Int. J. Cancer 83:456-464.
  • Veltman,IM. et al.,2005, Hum Mol Genet  14 (14):1955-63.
  • Koduri V. et al., 2007, Biochemistry 46:6570-7.
  • Size / Price
    Каталог: MG50200-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».