Быстрый заказ

Мышь MED10 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь MED10 Информация о продукте «Клон cDNA»
Размер кДНК:408 bp
Описание кДНК:Full length Clone DNA of Mus musculus mediator complex subunit 10
Синоним гена:AA959813,AI385605,C78613,D13Wsu50e
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
( We provide with MED10 qPCR primers for gene expression analysis, MP202152 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь MED10 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь MED10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52279-ACGRBS15400
Мышь MED10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52279-ACRRBS15400
Мышь MED10 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52279-ANGRBS15400
Мышь MED10 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52279-ANRRBS15400
Мышь MED10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52279-CFRBS13340
Мышь MED10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52279-CHRBS13340
Мышь MED10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52279-CMRBS13340
Мышь MED10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52279-CYRBS13340
Mouse MED10 Gene cDNA clone plasmidMG52279-GRBS5130
Мышь MED10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52279-NFRBS13340
Мышь MED10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52279-NHRBS13340
Мышь MED10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52279-NMRBS13340
Мышь MED10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52279-NYRBS13340
Мышь MED10 Джин клон кДНК в вектор клонированияMG52279-URBS5130
Мышь MED10 Джин ORF экспрессии кДНК клона плазмидыMG52279-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52279-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.