MDM2 cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

MDM2 cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1470 bp
Description
Full length Clone DNA of Mouse transformed mouse 3T3 cell double minute 2 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MDM2 cDNA ORF Clone, Mouse, N-HA tag: Alternative Names

1700007J15Rik cDNA ORF Clone, Mouse; AA415488 cDNA ORF Clone, Mouse; Mdm-2 cDNA ORF Clone, Mouse

MDM2 Background Information

MDM2 gene encodes a nuclear-localized E3 ubiquitin ligase. The encoded protein can promote tumor formation by targeting tumor suppressor proteins, such as p53, for proteasomal degradation. This gene is itself transcriptionally-regulated by p53. Overexpression or amplification of this locus is detected in a variety of different cancers. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in a multitude of transcript variants, many of which may be expressed only in tumor cells.
Full Name
MDM2 proto-oncogene, E3 ubiquitin protein ligase
References
  • Zhuo X, Ye H, Li Q, Xiang Z, Zhang X. Is MDM2 SNP309 Variation a Risk Factor for Head and Neck Carcinoma?: An Updated Meta-Analysis Based on 11,552 Individuals. Langevin. S, ed. Medicine. 2016;95(9):e2948.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait