After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь MDHA / MDH1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MDH1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_008618.3
Размер кДНК:1005bp
Описание кДНК:Full length Clone DNA of Mus musculus malate dehydrogenase 1, NAD (soluble).
Синоним гена:MDHA, Mor2, MDH-s, Mor-2, D17921, B230377B03Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь MDHA / MDH1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь MDHA / MDH1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51330-ACGRBS15400
Мышь MDHA / MDH1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51330-ACRRBS15400
Мышь MDHA / MDH1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51330-ANGRBS15400
Мышь MDHA / MDH1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51330-ANRRBS15400
Мышь MDHA / MDH1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51330-CFRBS13340
Мышь MDHA / MDH1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51330-CHRBS13340
Мышь MDHA / MDH1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51330-CMRBS13340
Мышь MDHA / MDH1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51330-CYRBS13340
Мышь MDHA / MDH1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51330-NFRBS13340
Мышь MDHA / MDH1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51330-NHRBS13340
Мышь MDHA / MDH1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51330-NMRBS13340
Мышь MDHA / MDH1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51330-NYRBS13340
Мышь MDHA / MDH1 Джин клон кДНК в вектор клонированияMG51330-URBS5130
Мышь MDHA / MDH1 Джин ORF экспрессии кДНК клона плазмидыMG51330-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Malate dehydrogenases 1(MDH1 / MDHA) is soluable form of malate dehydrogenases. Malate dehydrogenases (MDH) is a group of multimeric enzymes consisting of identical subunits usually organized as either dimer or tetramers with subunit molecular weights of 30-35 kDa. MDH has been isolated from different sources including archaea, eubacteria, fungi, plant and mammals. MDH catalyzes the NAD/NADH-dependent interconversion of the substrates malate and oxaloacetate. This reaction plays a key part in the malate / aspartate shuttle across the mitochondrial membrane, and in the tricarboxylic acid cycle within the mitochondrial matrix. The enzymes share a common catalytic mechanism and their kinetic properties are similar, which demonstrates a high degree of structural similarity. The three-dimensional structures and elements essential for catalysis are conserved between mitochondrial and cytoplasmic forms of MDH in eukaryotic cells even though these isoenzymes are only marginally related at the level of primary structure. 

Ссылки
  • Minarik P, et al. (2002) Malate dehydrogenases--structure and function. Gen Physiol Biophys. 21 (3): 257-65.
  • Musrati RA, et al. (1998) Malate dehydrogenase: distribution, function and properties. Gen Physiol Biophys. 17 (3): 193-210.
  • Hall MD, et al. (1992) Crystal structure of Escherichia coli malate dehydrogenase. A complex of the apoenzyme and citrate at 1.87 A resolution. J Mol Biol. 226 (3): 867-82.
  • Size / Price
    Каталог: MG51330-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».