Быстрый заказ

Мышь MBP/Myelin Basic Белок Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

  • other Green fluorescent protein / GFP Gene Plasmid Map 5612
ПаспортОбзорыСвязанные продуктыПротоколы
Мышь MBP Информация о продукте «Клон cDNA»
Размер кДНК:429 bp
Описание кДНК:Full length Clone DNA of Mus musculus myelin basic protein with C terminal HA tag.
Синоним гена:mld, shi, Hmbpr, C76307, R75289, golli-mbp
Участок рестрикции:KpnI + XbaI(6kb+0.43kb)
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
( We provide with MBP qPCR primers for gene expression analysis, MP201086 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь MBP/Myelin Basic Белок Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь MBP/Myelin Basic Белок Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51202-ACGRBS15400
Мышь MBP/Myelin Basic Белок Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51202-ACRRBS15400
Мышь MBP/Myelin Basic Белок Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51202-ANGRBS15400
Мышь MBP/Myelin Basic Белок Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51202-ANRRBS15400
Мышь MBP/Myelin Basic Белок Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51202-CFRBS13340
Мышь MBP/Myelin Basic Белок Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51202-CHRBS13340
Мышь MBP/Myelin Basic Белок Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51202-CMRBS13340
Мышь MBP/Myelin Basic Белок Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51202-CYRBS13340
Мышь MBP/Myelin Basic Белок Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51202-NFRBS13340
Мышь MBP/Myelin Basic Белок Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51202-NHRBS13340
Мышь MBP/Myelin Basic Белок Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51202-NMRBS13340
Мышь MBP/Myelin Basic Белок Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51202-NYRBS13340
Мышь MBP/Myelin Basic Белок Джин клон кДНК в вектор клонированияMG51202-URBS5130
Мышь MBP/Myelin Basic Белок Джин ORF экспрессии кДНК клона плазмидыMG51202-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51202-CY
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Добавить в корзинуЗапрос по оптовому заказу

Datasheet & Documentation

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.