After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Myoglobin Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MB Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001164047.1
Размер кДНК:465bp
Описание кДНК:Full length Clone DNA of Mus musculus myoglobin with N terminal His tag.
Синоним гена:AI325109
Виды:Mouse
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь Myoglobin Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь Myoglobin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51397-ACGRBS15400
Мышь Myoglobin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51397-ACRRBS15400
Мышь Myoglobin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51397-CFRBS13340
Мышь Myoglobin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51397-CHRBS13340
Мышь Myoglobin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51397-CMRBS13340
Мышь Myoglobin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51397-CYRBS13340
Мышь Myoglobin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51397-NFRBS13340
Мышь Myoglobin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51397-NHRBS13340
Мышь Myoglobin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51397-NMRBS13340
Мышь Myoglobin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51397-NYRBS13340
Мышь Myoglobin Джин клон кДНК в вектор клонированияMG51397-URBS5130
Мышь Myoglobin Джин ORF экспрессии кДНК клона плазмидыMG51397-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».