After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь MARCO Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MARCO Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_010766.2
Размер кДНК:1557bp
Описание кДНК:Full length Clone DNA of Mus musculus macrophage receptor with collagenous structure.
Синоним гена:Ly112; Scara2; AI323439; Marco
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь MARCO Джин ORF экспрессии кДНК клона плазмиды on other vectors
Product nameProduct name
Фон

Macrophage receptor MARCO, also known as Macrophage receptor with collagenous structure and Marco, is a single-pass type I I membrane protein. MARCO is a member of the class A scavenger receptor family and is part of the innate antimicrobial immune system. It is expressed in subpopulations of macrophages in the spleen and the medullary cord of lymph nodes. Although it is expressed on subsets of macrophages, it can be upregulated on other macrophages after bacterial infection. The strategic position of MARCO-expressing cells in lymphoid organs suggests an important role for this bacteria-binding molecule in removal of pathogens. MARCO has a short N-terminal cytoplasmic domain, a transmembrane domain, and a large extracellular part composed of a 75-residue long spacer domain, a 270-residue collagenous domain, and a 99-residue long scavenger receptor cysteine-rich (SRCR) domain. It is possible that cooperation between the SRCR domain and the collagenous domain is needed for high-affinity bacterial binding, or that the SRCR domain has to be in a trimeric form to effectively bind to bacteria

Ссылки
  • Kraal, G. et al., 2000, Microbes Infect . 2 (3): 313-6.
  • Sankala, M., 2002, J Biol Chem. 277 (36): 33378-85.
  • Arredouani, MS., 2004, Cell Mol Biol. 50 Online Pub : OL657-65.
  • Thakur, SA., 2009, Toxicol Sci. 107 (1): 238-46.
  • Size / Price
    Каталог: MG50283-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».