After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь JNK2/MAPK9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse MAPK9 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_016961.3
Размер кДНК:1146bp
Описание кДНК:Full length Clone DNA of Mus musculus mitogen-activated protein kinase 9 with C terminal Flag tag.
Синоним гена:JNK2, Prkm9, AI851083, p54aSAPK, Mapk9
Виды:Mouse
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь JNK2/MAPK9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Мышь JNK2/MAPK9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51022-ACGRBS15400
Мышь JNK2/MAPK9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51022-ACRRBS15400
Мышь JNK2/MAPK9 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51022-ANGRBS15400
Мышь JNK2/MAPK9 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51022-ANRRBS15400
Мышь JNK2/MAPK9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51022-CFRBS13340
Мышь JNK2/MAPK9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51022-CHRBS13340
Мышь JNK2/MAPK9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51022-CMRBS13340
Мышь JNK2/MAPK9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51022-CYRBS13340
Мышь JNK2/MAPK9 Джин клон кДНК в вектор клонированияMG51022-GRBS5130
Мышь JNK2/MAPK9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51022-NFRBS13340
Мышь JNK2/MAPK9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51022-NHRBS13340
Мышь JNK2/MAPK9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51022-NMRBS13340
Мышь JNK2/MAPK9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51022-NYRBS13340
Мышь JNK2/MAPK9 Джин ORF экспрессии кДНК клона плазмидыMG51022-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Mitogen-activated protein kinase 9 (MAPK9), also well known as c-Jun N-terminal kinase (JNK2), is a member of MAP kinase subfamily belonging to the protein kinase superfamily. MAPK9 responds to activation by environmental stress and pro-inflammatory cytokines by phosphorylating a number of transcription factors, such as c-Jun and ATF2. The crystal structure of human JNK2 complexed with an indazole inhibitor by applying a high-throughput protein engineering and surface-site mutagenesis approach. A novel conformation of the activation loop is observed, which is not compatible with its phosphorylation by upstream kinases. This activation inhibitory conformation of JNK2 is stabilized by the MAP kinase insert that interacts with the activation loop in an induced-fit manner. It suggest that the MAP kinase insert of JNK2 plays a role in the regulation of JNK2 activation, possibly by interacting with intracellular binding partners. JNK2 deficiency leads to reduced c-Jun degradation, thereby augmenting c-Jun levels and cellular proliferation, and suggests that JNK2 is a negative regulator of cellular proliferation in multiple cell types. JNK2 prevents replicative stress by coordinating cell cycle progression and DNA damage repair mechanisms. JNK2 blocks the ubiquitination of tumor suppressor p53, and thus increases the stability of p53 in nonstressed cells. JNK2 negatively regulates antigen-specific CD8+ T cell expansion and effector function, and thus selectively blocking JNK2 in CD8+ T cells may potentially enhance anti-tumor immune response. Lack of JNK2 expression was associated with higher tumor aneuploidy and reduced DNA damage response. Additionally,the JNK2 protein could be a novel therapeutic target in dry eye disease, and may provide a novel target for prevention of vascular disease and atherosclerosis.

Ссылки
  • Sabapathy K, et al. (2004) JNK2: a negative regulator of cellular proliferation. Cell Cycle. 3(12): 1520-3.
  • Tao J, et al. (2007) JNK2 negatively regulates CD8+ T cell effector function and anti-tumor immune response. Eur J Immunol. 37(3): 818-29.
  • Shaw D, et al. (2008) The crystal structure of JNK2 reveals conformational flexibility in the MAP kinase insert and indicates its involvement in the regulation of catalytic activity. J Mol Biol. 383(4): 885-93.
  • Osto E, et al. (2008) c-Jun N-terminal kinase 2 deficiency protects against hypercholesterolemia-induced endothelial dysfunction and oxidative stress. 118(20): 2073-80.
  • De Paiva CS, et al. (2009) Essential role for c-Jun N-terminal kinase 2 in corneal epithelial response to desiccating stress. Arch Ophthalmol. 127(12): 1625-31.
  • Chen P, et al. (2010) Jnk2 effects on tumor development, genetic instability and replicative stress in an oncogene-driven mouse mammary tumor model. PLoS One. 5(5): e10443.
  • Size / Price
    Каталог: MG51022-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».